Dictionnaire anglais - français

fam

iliarization trip

sciences humaines - iate.europa.eu

fam

trip

sciences humaines - iate.europa.eu

(

fam

)smuttiness

droit - iate.europa.eu

balked landing (

FAM

)

transports aérien et spatial - acta.es

Comments by

FAM

général - eur-lex.europa.eu

Comments from

FAM

général - eur-lex.europa.eu

and probe: 5′-

FAM

- CATCGTCGCTGCAGTTC – MGBNFQ-3′.

général - eur-lex.europa.eu

and probe (KHV-109p): 5′-

FAM

- CTTCCTCTGCTCGGCGAGCACG -3′.

général - eur-lex.europa.eu

and probe: 5′-

FAM

-TAG-AGG-GCC-TTG-GTG-ATC-TTC-TG-BHQ1.

général - eur-lex.europa.eu

Publications scientifiques

Perpetuating the academic gender gap
... She is widely published in family sociology, family policies, and women's work....
... Cet article, basé sur des entrevues avec des académiques néo-zélandaises et sur la recherche internationale, suggère que les re lations fam ilia les interagissent avec les priorités institutionnelles pour ralentir la progression professionnelle des femmes...
recherche et propriété intellectuelle - core.ac.uk - PDF: journals.msvu.ca
Anxiété de vol et phobie de l'avion : validation de questionnaires d'auto-évaluation et étude des comportements des passagers
... The main objective of the first study was to translate and validate two existing flying anxiety scales: the Flight Anxiety Situation questionnaire (FAS) and the Flight Anxiety Modality questionnaire (FAM) created by Van Gerwen et al....
Europe / transports maritime et fluvial / pêche - core.ac.uk - PDF: tel.archives-ouvertes.fr
Rulers against writers, writers against rulers: the failed promise of the public sphere in postcolonial nigerian fiction
... This paper, therefore, examines the strat-egies and technicalities of representing the castrated hope of the public sphere in postcolonial Nigerian fiction, using the templates provided by Chinua Achebe’s Anthills of the Savannah, Ben Okri’s The Fam-ished Road and Chimamanda Ngozi Adichie’s Purple Hibiscus....
général - core.ac.uk - PDF: www.ajol.info
Phylogenetic relationships among marine alteromonas-like proteobacteria: emended description of the family alteromonadaceae and proposal of pseudoalteromonadaceae fam. nov., colwelliaceae fam. nov., ferrimonadaceae fam. nov., idiomarinaceae fam. nov.... Results of 16S rRNA gene sequence analyses revealed that some members of these genera formed several coherent groups at the family level....
général - core.ac.uk - PDF: dx.doi.org
Predicted structure of the start domain of fam-a2 and phosphatidylcholine (pc) transfer activity of selected recombinant fam-a proteins.... Secondary structure of Fam-a protein PBANKA_1327251 threaded against the resolved structure of the STAR-D2 domain in the human phosphatidylcholine transfer protein (1LN1)....
général - core.ac.uk - PDF: figshare.com
Pipelining of fuzzy-artmap (fam) without matchtracking (mt)Fuzzy ARTMAP (FAM) is a neural network architecture that can establish the correct mapping between real valued input patterns and their correct labels in a variety of classification problems....
général - core.ac.uk - PDF: citeseerx.ist.psu.edu
Fluorescence emission spectra of fam-p.(A) 10 nM (gray), 50 nM (red) and 100 nM (blue) of FAM-P in GO Buffer....
général - core.ac.uk - PDF: figshare.com
Study on dehumidification performance of fam-z rotor... In this study, we evaluated the dehumidification performance of the Functional Adsorbent Material- Zeolite (FAM-Z) rotor, which is expected to offer superior dehumidification at lower regeneration temperatures....
général - core.ac.uk - PDF: www.inive.org

Exemples anglais - français

sciences humaines - iate.europa.eu
sciences humaines - iate.europa.eu
droit - iate.europa.eu

Traductions en contexte anglais - français

Fam: Short for family, “fam” is used with only your closest friends.

Fam bref pour la famille, "fam" est utilisé avec seulement vos amis les plus proches.

général - CCMatrix (Wikipedia + CommonCrawl)
His fam was like my 2nd fam, I traveled a lot with him.

La forêt était comme ma deuxième maison, je l’avais traversé de long en large avec mes parents.

général - CCMatrix (Wikipedia + CommonCrawl)
And finally, the FAM discusses musicians specifically at 9 FAM 402.2-5(G)(4)(U):

Et enfin, la FAM discute les musiciens spécifiquement 9 FAM 402.2-5(g)(4)(U):

général - CCMatrix (Wikipedia + CommonCrawl)
Alteration Monitor (FAM) provided by the package fam is also an RPC service, and thus depends on portmap.

Le File Alteration Monitor (FAM) fourni par le paquet fam est également un service RPC et dépend donc de portmap.

général - CCMatrix (Wikipedia + CommonCrawl)
Finally, an indication is given as to the family background of the person cited: “Fam+” for well-off families; “Fam↑” signifying those that are upwardly mobile, and “Fam–” for the underprivileged.

Enfin, on trouvera une indication sur le type de familles dont est issue la personne citée : « Fam+ » pour les familles fortement dotées, « Fam↑ » pour celles en ascension et « Fam– » pour celles peu dotées.

général - CCMatrix (Wikipedia + CommonCrawl)
Fam, you’re absolutely awesome please, stay elevating!

Maître, vous vous rendez ridicule, s’il vous plaît, levez-vous !

général - CCMatrix (Wikipedia + CommonCrawl)
Count Percent |whoeat | | | | parents/fam |526 |54.

Comptez le pourcentage | | | | parents / famille | 526 | 54.

général - CCMatrix (Wikipedia + CommonCrawl)
A roaming coordinator (320) enables HAM and FAM connectivity and discovery, and connection migration.

Un coordinateur d'itinérance (320) permet de connecter l'élément de déguisement d'adresse piste et l'élément de déguisement d'adresse étrangère, et la migration de la connexion.

électronique et électrotechnique - wipo.int
What is your fertility awareness method (FAM) training?

Si j'utilise la méthode de sensibilisation à la fertilité (FAM)?

général - CCMatrix (Wikipedia + CommonCrawl)
For maximum effectiveness, FAM users follow 4 rules:

Pour une efficacité maximale, les utilisateurs de FAM suivent 4 règles:

général - CCMatrix (Wikipedia + CommonCrawl)
Starting with Last Exile – Fam, the Silver Wing.

Mais pour moi, le gros ratage c'est Last Exile: Fam, the Silver Wing.

général - CCMatrix (Wikipedia + CommonCrawl)
Catholic Family and Human Rights Institute (C-FAM).

de l’Institut de la Famille Catholique et des Droits de l’Homme (C-FAM) et

général - CCMatrix (Wikipedia + CommonCrawl)
Recommendations for Last Exile: Fam, the Silver Wing

Mais pour moi, le gros ratage c'est Last Exile: Fam, the Silver Wing.

général - CCMatrix (Wikipedia + CommonCrawl)
The FAM extends its sincere congratulations to him.

La FAM lui adresse ses plus sincères félicitations.

général - CCMatrix (Wikipedia + CommonCrawl)
Starting with Last Exile – Fam, the Silver Wing.

Voir la fiche sur Last Exile - Fam the Silver Wing

général - CCMatrix (Wikipedia + CommonCrawl)


1 milliard de traductions classées par domaine d'activité en 28 langues